Took insert containing 3ARE + TATA box from A3-CAT using blunted HindIII and XhoI into pGL2-basic with a blunted EcoRI and XhoI. ARE sequence - TATCTGCTGCCCTAAAATGTGTATTCCATGGAAATGTCTGCCCTTCTCTC
NB: The A30-CAT map is attached, NOT the map for this plasmid (AR3-Lux)
Addgene has sequenced a portion of this plasmid for verification.
Click here for the sequencing
result.
Please acknowledge the principal investigator and cite this article if you use
this plasmid in a publication. Also, please include the text "Addgene plasmid
24643" in your Materials and Methods section.
Took insert containing 3ARE + TATA box from A3-CAT using blunted HindIII and XhoI into pGL2-basic with a blunted EcoRI and XhoI. ARE sequence - TATCTGCTGCCCTAAAATGTGTATTCCATGGAAATGTCTGCCCTTCTCTC
NB: The A30-CAT map is attached, NOT the map for this plasmid (AR3-Lux)