1
Plasmid 24643: pAR3-Lux
  • None

  • Luciferase

  • C terminal on backbone

  • pGL2-basic
    (Search Vector Database)

  • Mammalian Expression

  • 5597

  • 3ARE + TATA box

  • EcoRI

  • Yes

  • XhoI

  • Yes

  • LucNRev List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • View map

  • Jeff Wrana

  • MTA
    Luciferase Limited Use Label License

Comments: 

Took insert containing 3ARE + TATA box from A3-CAT using blunted HindIII and XhoI into pGL2-basic with a blunted EcoRI and XhoI. ARE sequence - TATCTGCTGCCCTAAAATGTGTATTCCATGGAAATGTCTGCCCTTCTCTC

NB: The A30-CAT map is attached, NOT the map for this plasmid (AR3-Lux)

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24643" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only