1
Browse > Cynthia Czajkowski > Venkatachalan et al > pUNIV backbone
Plasmid 24705: pUNIV backbone

  • None

  • EF177812

  • pCI-neo
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression, Bacterial Expression, Yeast Expression ; Xenopus oocyte expression

  • 5653

  • EcoRI

  • No

  • MluI

  • No

  • T7 List of Sequencing Primers

  • TATGTAGCTTAGAGACTCCATTCGGGTGTTC

  • Ampicillin

  • XL1 Blue

  • 37

  • Age I XL1-Blue

  • High Copy

  • Neomycin

  • View sequences (4)

  • Cynthia Czajkowski

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Optimized expression vector for ion channel studies in Xenopus oocytes and mammalian cells using alfalfa mosaic virus. Venkatachalan et al (Pflugers Arch. 2007 Apr . 454(1):155-63. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24705" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only