Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHPyV7-713a
(Plasmid #24728)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 24728 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFunnyfarm
  • Backbone manufacturer
    Christopher Buck lab, Addgene plasmid 24755
  • Backbone size w/o insert (bp) 2131
  • Vector type
    Viral clone

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Full genome of Human polyomavirus 7
  • Alt name
    Polyomavirus HPyV7 isolate 713a
  • Species
    polyomavirus
  • Insert Size (bp)
    4957
  • GenBank ID
    HM011566

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attPI (destroyed during cloning)
  • 3′ cloning site AttP2 (destroyed during cloning)
  • 5′ sequencing primer M13/pUC Forward
  • 3′ sequencing primer AsyR (CTGAAAGAGGAACTTGGTTAGG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

genome can be liberated by digestion with Mfe I.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHPyV7-713a was a gift from Christopher Buck (Addgene plasmid # 24728 ; http://n2t.net/addgene:24728 ; RRID:Addgene_24728)
  • For your References section:

    Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB.. Cell Host Microbe. 2010 Jun 25;7(6):509-15. 10.1016/j.chom.2010.05.006 PubMed 20542254