1
Plasmid 25700: HUW-TetO-hNanog
  • Nanog

  • 926

  • H. sapiens (human)

  • NANOG ()

  • FUW-TetO
    (Search Vector Database)

  • Lentiviral

  • 8377

  • EcoRI

  • No

  • EcoRI

  • No

  • AAAGTGAAAGTCGAGCTCGGTACC List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Unknown

  • View sequences (1)
  • Rudolf Jaenisch

  • MTA
    Tet Systems Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Direct cell reprogramming is a stochastic process amenable to acceleration. Hanna et al (Nature. 2009 Dec 3. 462(7273):595-601. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 25700" in your Materials and Methods section.