-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPD95.75
-
Backbone manufacturerA. Fire
- Backbone size w/o insert (bp) 4000
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesystemic RNA interference-deficient 1
-
Alt namesid-1
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)7860
-
Entrez Genesid-1 (a.k.a. CELE_C04F5.1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PvuI (not destroyed)
- 5′ sequencing primer TATAGGATCCTCATTTTTCCAGGTTCACAATG
- 3′ sequencing primer ATATAAGCGGCCGCAGAAAGGTGTCATGGTCTAGT (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Specific details about this vector are given at the Materials and Methods of the article: Calixto et al, 2010, Nat Meth "Enhanced Neuronal RNAi using sid-1"
Note that this plasmid contains genomic sid-1, NOT the cDNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TU#867 (Punc-119sid-1) was a gift from Martin Chalfie (Addgene plasmid # 25811 ; http://n2t.net/addgene:25811 ; RRID:Addgene_25811) -
For your References section:
Enhanced neuronal RNAi in C. elegans using SID-1. Calixto A, Chelur D, Topalidou I, Chen X, Chalfie M. Nat Methods. 2010 May 30. ():. 10.1038/nmeth.1463 PubMed 20512143
Map uploaded by the depositor.