This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #26149)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 26149 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number


  • Gene/Insert name
  • Alt name
  • Species
    Schmidtea mediterranea
  • Insert Size (bp)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CCTCGAGGTCGACGGTATC
  • 3′ sequencing primer AACAAAAGCTGGAGCTCCAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPR244-rap55 was a gift from Phillip Newmark (Addgene plasmid # 26149)
  • For your References section:

    A functional genomic screen in planarians identifies novel regulators of germ cell development. Wang Y, Stary JM, Wilhelm JE, Newmark PA. Genes Dev. 2010 Sep 15. 24(18):2081-92. 10.1101/gad.1951010 PubMed 20844018