1
Plasmid 26149: pPR244-rap55
  • Smed-rap55

  • rap55

  • 1373

  • Schmidtea mediterranea

  • HM055596

  • pPR244
    (Search Vector Database)

  • RNAi

  • 2650

  • CCTCGAGGTCGACGGTATC List of Sequencing Primers

  • AACAAAAGCTGGAGCTCCAC

  • Kanamycin

  • DH5alpha

  • 37

  • HT115(DE3)

  • Unknown

  • View sequences (1)
  • Phillip Newmark

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A functional genomic screen in planarians identifies novel regulators of germ cell development. Wang et al (Genes Dev. 2010 Sep 15. 24(18):2081-92. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26149" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with