Modified Shipping Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 23 - 27. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #26149)

Add to Cart
Available to Academic and Nonprofits Only


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
  • Alt name
  • Species
    Schmidtea mediterranea
  • Insert Size (bp)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CCTCGAGGTCGACGGTATC
  • 3′ sequencing primer AACAAAAGCTGGAGCTCCAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPR244-rap55 was a gift from Phillip Newmark (Addgene plasmid # 26149)
  • For your References section:

    A functional genomic screen in planarians identifies novel regulators of germ cell development. Wang Y, Stary JM, Wilhelm JE, Newmark PA. Genes Dev. 2010 Sep 15. 24(18):2081-92. 10.1101/gad.1951010 PubMed 20844018