pMV306G13+FFluc
(Plasmid #26157)

• Depositing Labs: Brian Robertson, Siouxsie Wiles
• Publication: Andreu et al PLoS One. 2010 May 24;5(5):e10777.

Backbone

• Vector backbone: pMV306
• Backbone size w/o insert (bp): 3995
• Vector type: Mycobacteria integrating vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: G13 promoter + Firefly luciferase
• Alt name: FFluc
• Alt name: Luc
• Species: Mycobacterium marinum + Photinus pyralis
• Insert Size (bp): 2155
• Mutation: Codon optimized for Mycobacterium tuberculosis. Lacks the last 3 aa

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: gatcgccactagcgccgcgg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Firefly luciferase gene codon optimised for Mycobacterium was cloned from pJ246:17659 obtained from Jeff Cirillo (Texas A&M) and Kevin Francis (Caliper Life Sciences)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry