pBPGAL4.1Uw
(Plasmid #26226)

Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Chloramphenicol
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    ccdB Survival 2T1 strain (Invitrogen), or equivalent, must be used to propagate plasmids carrying the ccdB gene.
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    GAL4
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2646
  • Entrez Gene
    GAL4 (a.k.a. YPL248C, GAL81)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer DSCP F: GAGCTCGCCCGGGGATC
  • 3′ sequencing primer GAL4 R: CGGCATCCTTGTTGACGTTAT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBPGAL4.1Uw was a gift from Gerald Rubin (Addgene plasmid # 26226)
  • For your References section:

    Refinement of Tools for Targeted Gene Expression in Drosophila. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Genetics. 2010 Aug 9. ():. 10.1534/genetics.110.119917 PubMed 20697123