Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #26226)


Item Catalog # Description Quantity Price (USD)
Plasmid 26226 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    ccdB Survival 2T1 strain (Invitrogen), or equivalent, must be used to propagate plasmids carrying the ccdB gene.
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • Entrez Gene
    GAL4 (a.k.a. YPL248C, GAL81)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer DSCP F: GAGCTCGCCCGGGGATC
  • 3′ sequencing primer GAL4 R: CGGCATCCTTGTTGACGTTAT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBPGAL4.1Uw was a gift from Gerald Rubin (Addgene plasmid # 26226)
  • For your References section:

    Refinement of Tools for Targeted Gene Expression in Drosophila. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Genetics. 2010 Aug 9. ():. 10.1534/genetics.110.119917 PubMed 20697123