Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pmRFPmars
(Plasmid #26252)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26252 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCerulean
  • Backbone manufacturer
    Martin Fraunholz
  • Backbone size w/o insert (bp) 6500
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mRFPmars
  • Species
    synthetic
  • Insert Size (bp)
    702
  • Mutation
    KpnI restriction site removed
  • GenBank ID
    AY679163
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctaatgcgctgttaatcactttac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mRFPmars received from Annette Müller-Taubenberger (Munich, Germany). Fischer, M., Haase, I., Simmeth, E., Gerisch, G. and Müller-Taubenberger, A. (2004). A brilliant monomeric red fluorescent protein to visualize cytoskeleton dynamics in Dictyostelium. FEBS Lett 577, 227-232.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Antibiotic selection: Ampicillin in E. coli, Chloramphenicol in S. aureus

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmRFPmars was a gift from Martin Fraunholz (Addgene plasmid # 26252 ; http://n2t.net/addgene:26252 ; RRID:Addgene_26252)
  • For your References section:

    Codon-improved fluorescent proteins in investigation of Staphylococcus aureus host pathogen interactions. Paprotka K, Giese B, Fraunholz MJ. J Microbiol Methods. 2010 Aug 10. ():. 10.1016/j.mimet.2010.07.022 PubMed 20708040