This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy in light of the new GDPR standards. When logging in or creating a new account, you will be asked to read and acknowledge these policy changes. Additionally, you can find our Transparency and Privacy Policy here.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #26252)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 26252 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Martin Fraunholz
  • Backbone size w/o insert (bp) 6500
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    KpnI restriction site removed
  • GenBank ID
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctaatgcgctgttaatcactttac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mRFPmars received from Annette Müller-Taubenberger (Munich, Germany). Fischer, M., Haase, I., Simmeth, E., Gerisch, G. and Müller-Taubenberger, A. (2004). A brilliant monomeric red fluorescent protein to visualize cytoskeleton dynamics in Dictyostelium. FEBS Lett 577, 227-232.
  • Terms and Licenses

Depositor Comments

Antibiotic selection: Ampicillin in E. coli, Chloramphenicol in S. aureus

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmRFPmars was a gift from Martin Fraunholz (Addgene plasmid # 26252)
  • For your References section:

    Codon-improved fluorescent proteins in investigation of Staphylococcus aureus host pathogen interactions. Paprotka K, Giese B, Fraunholz MJ. J Microbiol Methods. 2010 Aug 10. ():. 10.1016/j.mimet.2010.07.022 PubMed 20708040