1
Plasmid 26256: pBPHLWL-GAL4DBD
  • ZIP- Gal4DBD

  • RR12EE345L-Gal4DBD

  • GAL4

  • 640

  • S. cerevisiae (budding yeast)

  • GAL4 (YPL248C, GAL81)

  • pBPHLWL
    (Search Vector Database)

  • Bacterial Expression, Insect Expression ; Drosophila transgenesis

  • 7963

  • NotI

  • No

  • AscI

  • No

  • CAGTGCACGTTTGCTTGTTGA List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • pActPL-Gal4DBD (obtained from Addgene)

  • View sequences (4)
  • View map

  • Tom Clandinin

  • MTA

Comments: 

Luan et al. Neuron. 2006 Nov 9. 52(3):425-36.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A versatile in vivo system for directed dissection of gene expression patterns Gohl et al (Nature Methods (2011) doi:10.1038/nmeth.1561)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26256" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only