1
Plasmid 26260: pXL-BACII-attPGAL4LWL
  • GAL4

  • 2965

  • S. cerevisiae (budding yeast)

  • GAL4 (YPL248C, GAL81)

  • pXL-BacII-ECFP
    (Search Vector Database)

  • Bacterial Expression, Insect Expression ; Drosophila transgenesis

  • 9110

  • BamHI

  • No

  • SacI

  • No

  • CAGTGCACGTTTGCTTGTTGA List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • pGaTB (obtained from Drosophila Genomics Resource Center)

  • View sequences (5)
  • View map

  • Tom Clandinin

  • MTA

Comments: 

Brand and Perrimon. Development. 1993 Jun;118(2):401-15.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A versatile in vivo system for directed dissection of gene expression patterns Gohl et al (Nature Methods (2011) doi:10.1038/nmeth.1561)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26260" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only