Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #26271)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 26271 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7560
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    p21 shRNA
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TGCAGGGGAAAGAATAGTAGAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

The shRNA is directed against the mouse p21 sequence 5'- gagaacggtggaactttga -3'.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PSICORhp-mp21(v1) was a gift from Rudolf Jaenisch (Addgene plasmid # 26271)
  • For your References section:

    Direct cell reprogramming is a stochastic process amenable to acceleration. Hanna J, Saha K, Pando B, van Zon J, Lengner CJ, Creyghton MP, van Oudenaarden A, Jaenisch R. Nature. 2009 Dec 3. 462(7273):595-601. 10.1038/nature08592 PubMed 19898493