Plasmid 26272: PSICORhp-mp21(v2)
  • p21 shRNA

  • 55

  • M. musculus (mouse)

  • pSicoR
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, RNAi, Cre/Lox

  • 7560

  • HpaI

  • Yes

  • XhoI

  • Unknown

  • TGCAGGGGAAAGAATAGTAGAC List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • Puromycin

  • View sequences (2)
  • Rudolf Jaenisch



The shRNA is directed against the mouse p21 sequence 5'- gcagattggtcttctgcaa -3'.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Direct cell reprogramming is a stochastic process amenable to acceleration. Hanna et al (Nature. 2009 Dec 3. 462(7273):595-601. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26272" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only