1
Plasmid 26274: pBRPyCAG-fmKlf4-DsRed-Ip
  • Klf4

  • 1450

  • M. musculus (mouse)

  • Klf4 (RP23-322L22.2, EZF, Gklf, Zie)

  • pBRYCAG-floxStop dsRED-IresPuro
    (Search Vector Database)

  • Mammalian Expression, Cre/Lox

  • 8050

  • XhoI

  • No

  • NotI

  • No

  • gtccccttctccctctccagcctcgg List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • View sequences (2)
  • Rudolf Jaenisch

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Hanna et al (Proc Natl Acad Sci U S A. 2010 May 18. 107(20):9222-7. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26274" in your Materials and Methods section.