-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBRYCAG-floxStop dsRED-IresPuro
- Backbone size w/o insert (bp) 8050
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKlf2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1700
-
Entrez GeneKLF2 (a.k.a. LKLF)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer gtccccttctccctctccagcctcgg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Full length cDNA cloned by blunt ligation
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBRPyCAG-hKlf2-DsRed-Ip was a gift from Rudolf Jaenisch (Addgene plasmid # 26277 ; http://n2t.net/addgene:26277 ; RRID:Addgene_26277) -
For your References section:
Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Hanna J, Cheng AW, Saha K, Kim J, Lengner CJ, Soldner F, Cassady JP, Muffat J, Carey BW, Jaenisch R. Proc Natl Acad Sci U S A. 2010 May 18. 107(20):9222-7. 10.1073/pnas.1004584107 PubMed 20442331