-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26596 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSIH1-H1-puro
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 7200
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSTAT3 shRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)60
-
Entrez GeneSTAT3 (a.k.a. ADMIO, ADMIO1, APRF, HIES)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer agtgtcactaggcgggaacac (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
STAT3 shRNA sequence: gatccGCATCTGCCTAGATCGGCTATTCAAGAGATAGCCGATCTAGGCAGATGTTTTTTg
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIH1-puro-STAT3 shRNA was a gift from Frank Sinicrope (Addgene plasmid # 26596 ; http://n2t.net/addgene:26596 ; RRID:Addgene_26596) -
For your References section:
Sorafenib inhibits STAT3 activation to enhance TRAIL-mediated apoptosis in human pancreatic cancer cells. Huang S, Sinicrope FA. Mol Cancer Ther. 2010 Mar . 9(3):742-50. 10.1158/1535-7163.MCT-09-1004 PubMed 20197401