Plasmid 26597: pSIH1-puro-control shRNA
  • control shRNA

  • 60

  • pSIH1-H1-puro
    (Search Vector Database)

  • System Biosciences

  • Lentiviral, RNAi

  • 7200

  • BamHI

  • No

  • EcoRI

  • No

  • agtgtcactaggcgggaacac List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • Puromycin

  • View sequences (1)
  • Frank Sinicrope




Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Sorafenib inhibits STAT3 activation to enhance TRAIL-mediated apoptosis in human pancreatic cancer cells. Huang et al (Mol Cancer Ther. 2010 Mar . 9(3):742-50. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26597" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only