pSIH1-puro-control shRNA
(Plasmid #26597)

Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
    System Biosciences
  • Backbone size (bp) 7200
  • Vector type
    Lentiviral, RNAi
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
    control shRNA
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agtgtcactaggcgggaacac
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments


How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIH1-puro-control shRNA was a gift from Frank Sinicrope (Addgene plasmid # 26597)
  • For your References section:

    Sorafenib inhibits STAT3 activation to enhance TRAIL-mediated apoptosis in human pancreatic cancer cells. Huang S, Sinicrope FA. Mol Cancer Ther. 2010 Mar . 9(3):742-50. 10.1158/1535-7163.MCT-09-1004 PubMed 20197401