Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEM-3z/601
(Plasmid #26656)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26656 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEM-3Z
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2743
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Insert Size (bp)
    282

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HincII (unknown if destroyed)
  • 3′ cloning site HincII (unknown if destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer SP6
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"601".

Primers that are used by the Widom lab to amplify the 147 bp fragment:

Forward:
ctggagaatcccggtgccg

Reverse:
acaggatgtatatatctgacacg

Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM-3z/601 was a gift from Jonathan Widom (Addgene plasmid # 26656 ; http://n2t.net/addgene:26656 ; RRID:Addgene_26656)
  • For your References section:

    New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. Lowary PT, Widom J. J Mol Biol. 1998 Feb 13. 276(1):19-42. 10.1006/jmbi.1997.1494 PubMed 9514715