pEnt R3L2-MCS
(Plasmid #26799)

• Depositing Lab: Edward Hsiao
• Publication: Hsiao et al Stem Cell Res Ther. 2011 Mar 4. 2(2):11.

Backbone

• Vector backbone: pEntr2B
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2100
• Vector type: Gateway Entry vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: multiple cloning sequence
• Alt name: MCS
• Insert Size (bp): 200

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCTACAAACTCTTCCTGTTAGT
• 3′ sequencing primer: AGAGATTTTGAGACACGGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Empty entry vector carrying Gateway R3L2 sites, with MCS. This plasmid can act as an empty carrier when combined with a L1L3 plasmid to generate expression plasmids carrying just the L1L3 component.

This plasmid was constructed as follows: The pEntr2B entry vector was digested with AflII and XhoI to remove the attL1 and ccdb genes. Oligos
containing the attR3 site flanked by AflII on the 5' end and a polylinker (NotI-PacI-Bsu36I-NdeI-XhoI) on the 3' end were ligated to generate pEntR3L2-MCS.