This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-CaMKIIa-hChR2(H134R)-mCherry
(Plasmid #26975)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26975 Plasmid sent as bacteria in agar stab 1 $65
AAV1 26975-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL)
and Plasmid. More Information
$380
AAV5 26975-AAV5 Virus (100 µL at titer ≥ 1×10¹³ vg/mL)
and Plasmid. More Information
$380

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5386
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hChR2(H134R)
  • Alt name
    hChR2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1647
  • Mutation
    H134R
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI, AgeI (not destroyed)
  • 3′ cloning site EcoRI, HinDIII (not destroyed)
  • 5′ sequencing primer ctcagaagccccaagctcgtc
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit - http://www.optogenetics.org

Information for AAV1 (Catalog # 26975-AAV1) ( Back to top )

Purpose

Ready-to-use AAV1 particles produced from pAAV-CaMKIIa-hChR2(H134R)-mCherry (#26975). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hChR2(H134R)-mCherry plasmid DNA.

CaMKIIa-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR or digital droplet PCR: The number of genome copies in viral preparations was measured by real-time qPCR or by digital droplet PCR. Titering on these preparations was performed by the University of Pennsylvania Vector Core. Read Addgene's AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by SYPRO Red staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.

Visit our viral production page for more information.

Information for AAV5 (Catalog # 26975-AAV5) ( Back to top )

Purpose

Ready-to-use AAV5 particles produced from pAAV-CaMKIIa-hChR2(H134R)-mCherry (#26975). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hChR2(H134R)-mCherry plasmid DNA.

CaMKIIa-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR or digital droplet PCR: The number of genome copies in viral preparations was measured by real-time qPCR or by digital droplet PCR. Titering on these preparations was performed by the University of Pennsylvania Vector Core. Read Addgene's AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by SYPRO Red staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-hChR2(H134R)-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 26975)

    For viral preps, please replace (Addgene plasmid # 26975) in the above sentence with: (Addgene viral prep # 26975-AAV1) or (Addgene viral prep # 26975-AAV5)