Plasmid 26975: pAAV-CaMKIIa-hChR2(H134R)-mCherry
  • AAV expression of humanized ChR2(H134R) fused to mCherry driven by CaMKIIa promoter for optogenetic activation

  • hChR2(H134R)

  • hChR2

  • 1647

  • H. sapiens (human)

  • mCherry

  • C terminal on insert

  • H134R

  • pAAV
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 5386

  • BamHI, AgeI

  • No

  • EcoRI, HinDIII

  • No

  • ctcagaagccccaagctcgtc List of Sequencing Primers


  • Ampicillin

  • Stbl3

  • 37

  • Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.

  • High Copy

  • View sequences (4)
  • View map

  • View map

  • Karl Deisseroth

    Clontech Limited Use Label License
    Ancillary Agreement for Plasmids Containing FP Materials


This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26975" in your Materials and Methods section.