1
Plasmid 27105: pEnt L1L3 tTA-3
  • tetracycline transactivator

  • tTA

  • 1100

  • pEntr2B
    (Search Vector Database)

  • Invitrogen

  • Gateway entry vector

  • 2300

  • Gateway Cloning

  • TCTACAAACTCTTCCTGTTAGT List of Sequencing Primers

  • AGAGATTTTGAGACACGGGC

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Edward Hsiao

  • MTA
    Tet Systems Limited Use Label License

Comments: 

Gateway L1L3 entry vector containing the tTA regulator. Promoters can be inserted using PacI and SbfI. Does not contain insulator sequence.

Plasmid was constructed as follows: The pEntr2B entry vector (Invitrogen) was digested with PstI and XhoI to remove the attL2 site.
Oligonucleotides containing SalI-XhoI-Bsu36I-NdeI-PacI-EcoRI-NotI flanking the attL3 sequence on the 5' side
and PstI on the 3' side were ligated in to create an intermediate plasmid carrying attL1 and attL3 sites. A LoxP sequence was introduced at the XhoI site. The tTA and pA sequences were subsequently cloned into the EcoRI/NotI sites by PCR cloning from pUHG15-1 to generate pEntL1L3 tTA-3.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Constitutive Gs activation using a single-construct tetracycline-inducible expression system in embryonic stem cells and mice Hsiao et al (Stem Cell Res Ther. 2011 Mar 4;2(2):11. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 27105" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with
27106: pEnt L1L3 rtTA-3
22687: pFNF