1
Plasmid 27185: xylt1_R (OZ510)
  • Zinc finger array targeting xylt1

  • xylosyltransferase 1

  • OZ510

  • 270

  • D. rerio (zebrafish)

  • ENSDARG00000061248

  • xylt1 ()

  • MG414
    (Search Vector Database)

  • Zebrafish Targeting

  • 5493

  • XbaI

  • No

  • BamHI

  • No

  • OK.61 GGGTAGTACGATGACGGAACCTGTC List of Sequencing Primers

  • Kanamycin

  • XL1 Blue

  • 37

  • Requires a bacterial strain such as XL1 Blue, that expresses the lacIq allele of lac repressor

  • Low Copy

  • View sequences (1)
  • Keith Joung

  • MTA

Comments: 

This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene xylt1 (see below). Please note that this plasmid does NOT contain the xylt1 sequence.

Users must order the complementary plasmid xylt1_L (OZ509) [Addgene plasmid 27184] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.

Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203).


This zinc finger array was tested for binding activity to the sequence 5'-GTAGCGGGT-3' in a bacterial two hybrid assay, and resulted in 5.09 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).

Scientists using this zinc finger array in a publication should notify zebrafishzfs@zincfingers.org and acknowledge NIH grant number R01 GM088040 in the publication.

Other Articles:
"Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082

"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Rapid "open-source" engineering of customized zinc-finger nucleases for highly efficient gene modification. Maeder et al (Mol Cell. 2008 Jul 25. 31(2):294-301. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 27185" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with