-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepECFP N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3984
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCerulean N1
-
Alt namemCerulean-N1
-
Insert Size (bp)720
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was created by mutagenesis of pECFP-N1. When compared with ECFP, Cerulean contains the following mutations: S72A, Y145A and H148D. This construct also contains A206K mutation to create a monomeric form of the fluorescent protein.
See Addgene's sequencing results for detailed MCS and mCerulean. This plasmid is designed to clone a gene of interest upstream and in-frame to create a C-terminal mCerulean fusion protein.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCerulean N1 was a gift from Steven Vogel (Addgene plasmid # 27795 ; http://n2t.net/addgene:27795 ; RRID:Addgene_27795) -
For your References section:
Cerulean, Venus, and VenusY67C FRET reference standards. Koushik SV, Chen H, Thaler C, Puhl HL, Vogel SS. Biophys J. 2006 Dec 15. 91(12):L99-L101. 10.1529/biophysj.106.096206 PubMed 17040988