Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Amber C1
(Plasmid #27797)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 27797 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    mVenus C1
  • Backbone manufacturer
    Addgene plasmid# 27794
  • Backbone size w/o insert (bp) 3984
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mAmber C1
  • Insert Size (bp)
    720

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe 1 (not destroyed)
  • 3′ cloning site Bam HI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Amber was created by mutating Tyrosine 67 in Venus to Cysteine (Y67C).

See Addgene's sequencing results for detailed Amber and MCS. This plasmid is designed to clone a gene of interest downstream and in-frame to create a N-terminal Amber fusion protein.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Amber C1 was a gift from Steven Vogel (Addgene plasmid # 27797 ; http://n2t.net/addgene:27797 ; RRID:Addgene_27797)
  • For your References section:

    Cerulean, Venus, and VenusY67C FRET reference standards. Koushik SV, Chen H, Thaler C, Puhl HL, Vogel SS. Biophys J. 2006 Dec 15. 91(12):L99-L101. 10.1529/biophysj.106.096206 PubMed 17040988