Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-EF1a-Backbone(NN)
(Plasmid #27961)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 27961 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 9204
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TAL-Backbone(NN)
  • Alt name
    Backbone(NN)
  • Species
    Synthetic
  • Insert Size (bp)
    2349

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTTTGAGTTTGGATCTTGGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-EF1a-Backbone(NN) was a gift from Feng Zhang (Addgene plasmid # 27961 ; http://n2t.net/addgene:27961 ; RRID:Addgene_27961)
  • For your References section:

    Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang F, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Nat Biotechnol. 2011 Feb;29(2):149-53. doi: 10.1038/nbt.1775 10.1038/nbt.1775 PubMed 21248753