SF-1 shRNA #3
(Plasmid
#28188)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRNAT-CMV3.1/Neo
-
Backbone manufacturerGenscript
- Backbone size w/o insert (bp) 6478
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNr5a1 shRNA
-
Alt nameNr5a1
-
SpeciesM. musculus (mouse)
-
Entrez GeneNr5a1 (a.k.a. Ad4BP, ELP, ELP-3, Ftz-F1, Ftzf1, SF-1, SF1, STF-1)
-
Tag
/ Fusion Protein
- cGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CMV-F
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA #3 sequence: GATCCTCAATGAGAAGGTTGTTGCGGTTGATATCCGCCGCAACAACCTTCTCATTGACGC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SF-1 shRNA #3 was a gift from Bernard Schimmer (Addgene plasmid # 28188 ; http://n2t.net/addgene:28188 ; RRID:Addgene_28188) -
For your References section:
Contributions of specificity protein-1 and steroidogenic factor 1 to Adcy4 expression in Y1 mouse adrenal cells. Rui X, Tsao J, Scheys JO, Hammer GD, Schimmer BP. Endocrinology. 2008 Jul . 149(7):3668-78. 10.1210/en.2008-0203 PubMed 18388192