Addgene - DECIPHER Lenti shRNA Library, Human Mod 3: Cell Surface, etc. Plasmid Data

cDNA or shRNA Library 29589: DECIPHER Lenti shRNA Library, Human Mod 3: Cell Surface, etc.

Gene/insert name:
Cell Surface, Extracellular, and DNA Binding Targets
Alt name:
4,922 targets; 27,500 shRNAs
Insert size:
108
Species:
H. sapiens (human)
Mutation:
Bar-code downstream of shRNA
Vector backbone:
pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro
(Search Vector Database)
Backbone manufacturer:
Cellecta , Available from Addgene (#28289)
Vector type:
Mammalian Expression, Lentiviral, RNAi
Backbone size w/o insert (bp):
7500
Cloning site 5':
BbsI (BpiI)
Site destroyed during cloning:
Yes
Cloning site 3':
BbsI (BpiI)
Site destroyed during cloning:
Yes
5' sequencing primer:
FwdU6 (CAAGGCTGTTAGAGAGATAATTGGAA) List of Sequencing Primers
Bacterial resistance(s)
Ampicillin
Growth strain(s)
NA
Growth temperature (℃):
37
Growth instructions:
Plasmids need to be grown in OmniMAX 2 T1R (Life Technologies) or SURE (Agilent) Recombination defective E.coli cells
High or low copy:
Unknown
Selectable markers:
Puromycin
Map:
View map
Supplemental document:
DECIPHER Project Website
Supplemental document:
DECIPHER Data and Pathway Analysis Software
Supplemental document:
DECIPHER Resources (includes link to User Manual)
Principal Investigator:
Alex Chenchik
Terms and Licenses:
MTA
Agilent Technologies Inc End User Label License for the use of Cellecta shRNA libraries comprising Oligo Pools
Cellecta Lentiviral Pooled Plasmid and Packaged shRNA Libraries Limited Use Label License
Evrogen IP JSC End User Label License for the use of Cellecta lentiviral shRNA constructs comprising TagRFP-encoded gene
Life Technologies Corporation End-User Label License for the use of Cellecta Lentiviral Expression System

Comments:

Library is supplied as 120μl of DNA at 1.0μg/μl

DECIPHER libraries are bar-coded lentiviral shRNA libraries optimized for RNAi Genetic Screens in pooled format. Human Module 3 targets 4,922 genes. This new Module adds additional cell surface, extracellular, DNA binding targets, and other genes to the well-annotated signal transduction and disease-associated genes primarily targeted with the first two modules of the human shRNA library. Many of the genes targeted in Module 3 are conserved and appear integral to a variety of important biological process but are not as well characterized as the 10,000 genes targeted in the first two modules.

PLEASE NOTE: The DECIPHER shRNA are designed for target mRNA associated with the RefSeq#, not the HUGO gene symbol. We can't guarantee that the gene symbols indicated are accurate, as there may be synonyms, nomenclature updates/changes, or other discrepancies in naming that are beyond our control. Please see the HUGO Gene Nomenclature Committee website at http://www.genenames.org/hgnc-guidelines for more information.

This plasmid has not been sequence verified. If you would like Addgene to sequence a portion of this plasmid before you request it, please contact us.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 29589" in your Materials and Methods section.