-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFPV27
-
Backbone manufacturerRamakrishnan et al., 2000
- Backbone size w/o insert (bp) 4981
-
Vector typeMycobacteria expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMycobacterium Strong Promoter (MSP)
-
Alt namepMSP12::mOrange2
-
SpeciesM. marinum
-
Insert Size (bp)500
-
Tag
/ Fusion Protein
- mOrange2 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
- 3′ sequencing primer Kan-Rev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance. The GFP was then replaced with mOrange2. The mOrange2 ORF is present at bp# 5620-6330.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTEC16 was a gift from Lalita Ramakrishnan (Addgene plasmid # 30175 ; http://n2t.net/addgene:30175 ; RRID:Addgene_30175) -
For your References section:
Evaluation of the pathogenesis and treatment of Mycobacterium marinum infection in zebrafish. Takaki K, Davis JM, Winglee K, Ramakrishnan L. Nat Protoc. 2013 Jun;8(6):1114-24. doi: 10.1038/nprot.2013.068. Epub 2013 May 16. 10.1038/nprot.2013.068 PubMed 23680983