-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4300
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namealpha 5 integrin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3200
-
Mutation91-544 of enhancer region of CMV promoter removed to reduce expression
-
GenBank IDXO6256
-
Entrez GeneITGA5 (a.k.a. CD49e, FNRA, VLA-5, VLA5A)
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer AGCGGCACTCTGACTTGAGCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byReduced expression promoter was received from Dr. Tim Mitchison (Harvard Medical School). Alpha-5 integrin was received from Dr. Louis Reichardt (UCSF).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Reduced Expression Alpha-5-Integrin-GFP was a gift from Rick Horwitz (Addgene plasmid # 30450 ; http://n2t.net/addgene:30450 ; RRID:Addgene_30450)