-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAV1k
- Backbone size w/o insert (bp) 2792
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebeta-glucuronidase
-
Alt namegusA
-
Alt namepIM1440
-
SpeciesEscherichia coli
-
Insert Size (bp)1796
-
GenBank IDJF828582
-
Entrez GenegusA (a.k.a. ECO111_2086)
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI, EcoRI, NheI, SphI (not destroyed)
- 3′ cloning site SpeI, PstI, ClaI, HindIII (not destroyed)
- 5′ sequencing primer gacgaactccaattcactgttccttgc
- 3′ sequencing primer ggagagcgttcaccgacaaacaacag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
In our experience, plasmid yields are highest when cells are harvested at late log stage.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lacI-PT5-gusA-pBAV1k was a gift from Ichiro Matsumura (Addgene plasmid # 30501 ; http://n2t.net/addgene:30501 ; RRID:Addgene_30501) -
For your References section:
Expression vectors for the engineering of genes and genomes in Acinetobacter baylyi ADP1. Murin CD, Segal K, Bryksin A, Matsumura I. Appl Environ Microbiol. 2011 Oct 21. 10.1128/AEM.05597-11 PubMed 22020504