1
Plasmid 30503: lacI-Ptac-gusA-pBAV1k
  • beta-glucuronidase

  • gusA

  • pIM1445

  • 1796

  • Escherichia coli

  • JF828584

  • gusA (ECO111_2086)

  • His

  • N terminal on insert

  • pBAV1k
    (Search Vector Database)

  • Bacterial Expression

  • 2792

  • EcoRI, XbaI, NheI, SphI

  • No

  • HindIII, SpeI, PstI, ClaI

  • No

  • gacgaactccaattcactgttccttgc List of Sequencing Primers

  • ggagagcgttcaccgacaaacaacag

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • This lab.

  • View sequences (2)
  • View map

  • Ichiro Matsumura

  • MTA

Comments: 

In our experience, plasmid yields are highest when cells are harvest at late log stage.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Expression vectors for the engineering of genes and genomes in Acinetobacter baylyi ADP1. Murin et al (Appl Environ Microbiol. 2011 Oct 21. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30503" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only