This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #30505)


Item Catalog # Description Quantity Price (USD)
Plasmid 30505 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Any strain that has LacI repressor.
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    Escherichia coli
  • Insert Size (bp)
  • Entrez Gene
    gusA (a.k.a. ECO111_2086)
  • Tag / Fusion Protein
    • His (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, XbaI (not destroyed)
  • 3′ cloning site SpeI, PstI (not destroyed)
  • 5′ sequencing primer gacgaactccaattcactgttccttgc
  • 3′ sequencing primer ggagagcgttcaccgacaaacaacag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This lab.
  • Terms and Licenses

Depositor Comments

In our experience, plasmid yields are highest when cells are harvest at late log stage.

Note that this plasmid also confers resistance to Spectinomycin, but Addgene provides it in an Amp stab.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pp2.1-PT5-lacI-gusA-specR-pp2.2-IMBB was a gift from Ichiro Matsumura (Addgene plasmid # 30505 ; ; RRID:Addgene_30505)
  • For your References section:

    Expression vectors for the engineering of genes and genomes in Acinetobacter baylyi ADP1. Murin CD, Segal K, Bryksin A, Matsumura I. Appl Environ Microbiol. 2011 Oct 21. 10.1128/AEM.05597-11 PubMed 22020504