pCS2-F1-GCC
(Plasmid #30698)

Loading...
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    XL1Blue
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    F1 GCC
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    267
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer SP6
  • 3′ sequencing primer GTAATACGACTCACTATAGTT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2-F1-GCC was a gift from Nathan Lawson & Scot Wolfe (Addgene plasmid # 30698)
  • For your References section:

    Evaluation and application of modularly assembled zinc-finger nucleases in zebrafish. Zhu C, Smith T, McNulty J, Rayla AL, Lakshmanan A, Siekmann AF, Buffardi M, Meng X, Shin J, Padmanabhan A, Cifuentes D, Giraldez AJ, Look AT, Epstein JA, Lawson ND, Wolfe SA. Development. 2011 Oct;138(20):4555-64. 10.1242/dev.066779 PubMed 21937602