This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #30701)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 30701 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    High Copy


  • Gene/Insert name
    F1 GGA, F2 GTG, F3 TTG
  • Insert Size (bp)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer SP6
  • 3′ sequencing primer attaaccctcactaaaggga
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2-F1-GGA-F2-GTG-F3-TTG was a gift from Nathan Lawson & Scot Wolfe (Addgene plasmid # 30701)
  • For your References section:

    Evaluation and application of modularly assembled zinc-finger nucleases in zebrafish. Zhu C, Smith T, McNulty J, Rayla AL, Lakshmanan A, Siekmann AF, Buffardi M, Meng X, Shin J, Padmanabhan A, Cifuentes D, Giraldez AJ, Look AT, Epstein JA, Lawson ND, Wolfe SA. Development. 2011 Oct;138(20):4555-64. 10.1242/dev.066779 PubMed 21937602