Plasmid 30722: pCS2-F2-GCG
  • F2 GCG

  • 267

  • HA

  • N terminal on insert

  • pCS2 (modified)
    (Search Vector Database)

  • mRNA production

  • 2877

  • KpnI

  • No

  • XbalI

  • No

  • SP6 List of Sequencing Primers

  • attaaccctcactaaaggga

  • Ampicillin

  • DH5alpha

  • 37

  • XL1Blue

  • High Copy

  • View sequences (2)
  • Nathan Lawson

  • Scot Wolfe


Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Evaluation and application of modularly assembled zinc-finger nucleases in zebrafish. Zhu et al (Development. 2011 Oct;138(20):4555-64. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30722" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with