pCS2-F3-GCT
(Plasmid
#30741)
-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30741 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2 (modified)
- Backbone size w/o insert (bp) 6141
-
Vector typemRNA production
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsXL1Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameF3 GCT
-
Insert Size (bp)267
-
Tag
/ Fusion Protein
- FLAG tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer SP6
- 3′ sequencing primer attaaccctcactaaaggga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2-F3-GCT was a gift from Nathan Lawson & Scot Wolfe (Addgene plasmid # 30741 ; http://n2t.net/addgene:30741 ; RRID:Addgene_30741) -
For your References section:
Evaluation and application of modularly assembled zinc-finger nucleases in zebrafish. Zhu C, Smith T, McNulty J, Rayla AL, Lakshmanan A, Siekmann AF, Buffardi M, Meng X, Shin J, Padmanabhan A, Cifuentes D, Giraldez AJ, Look AT, Epstein JA, Lawson ND, Wolfe SA. Development. 2011 Oct;138(20):4555-64. 10.1242/dev.066779 PubMed 21937602