1
Plasmid 30998: pNI3
  • repeat NI3

  • 117

  • Xanthamonas oryzae

  • pTC14
    (Search Vector Database)

  • 2989

  • XbaI

  • No

  • XhoI

  • No

  • pTC14_F2 (caagcctgattgggagaaaa) List of Sequencing Primers

  • Tetracycline

  • DH5alpha

  • 37

  • DH10B/LB+antibiotics

  • High Copy

  • View sequences (2)
  • Adam Bogdanove

  • Daniel Voytas

  • UBMTA
    Cellectis Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak et al (Nucleic Acids Res. 2011 Apr 14. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30998" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only