Modified Shipping Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 23 - 27. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #30998)

Add to Cart
Available to Academic and Nonprofits Only


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
    repeat NI3
  • Species
    Xanthamonas oryzae
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer pTC14_F2 (caagcctgattgggagaaaa)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNI3 was a gift from Adam Bogdanove & Daniel Voytas (Addgene plasmid # 30998)
  • For your References section:

    Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Apr 14. ():. 10.1093/nar/gkr218 PubMed 21493687