pTAL4
(Plasmid #31035)

• Depositing Labs: Adam Bogdanove, Daniel Voytas
• Publication: Cermak et al Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218

Backbone

• Vector backbone: pDW1789_Leu
• Backbone size w/o insert (bp): 6519
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5a/LB+antibiotics
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TALEN-FokI nuclease backbone
• Species: Xanthamonas oryzae
• Insert Size (bp): 1948
• Tags / Fusion Proteins:
  • FokI nuclease (C terminal on insert)
  • AcV5

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TEF_seq (ggtcttcaatttctcaagtttc) TAL_F1 (ttggcgtcggcaaacagtgg)
• 3′ sequencing primer: homodimer_rev (aattcagatttcactagctg) TAL_R2 (ggcgacgaggtggtcgttg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Cellectis Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expression of the TAL-FokI homodimer in yeast.

NOTE: The GenBank file associated with this plasmid (accessible from the Golden Gate TALEN kit page) erroneously lists this plasmid as having a D450A codon (A--C) FokI mutation.