1
Plasmid 31073: pcDNA6.2-GW/EmGFP-miR-SUMO23
  • SUMO2/3 microRNA

  • SUMO2/3

  • SUMO2: GATCTGCCTCATTGACAAAC; SUMO3: AATCGAATCTGCCTCATTGAC

  • H. sapiens (human)

  • SUMO2 (HSMT3, SMT3B, SMT3H2, SUMO3, Smt3A)
    SUMO3 (SMT3A, SMT3H1, SUMO-3, Smt3B)

  • EmGFP

  • N terminal on backbone

  • pcDNA6.2-GW/EmGFP
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression, RNAi

  • 5699

  • attB1

  • Unknown

  • attB2

  • Unknown

  • EGFP-C List of Sequencing Primers

  • Spectinomycin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • Wulf Paschen

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Gene expression and cell growth are modified by silencing SUMO2 and SUMO3 expression. Yang et al (Biochem Biophys Res Commun. 2009 Apr 24. 382(1):215-8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31073" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only