pcDNA6.2-GW/EmGFP-miR-SUMO23
(Plasmid #31073)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pcDNA6.2-GW/EmGFP
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5699
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    SUMO2/3 microRNA
  • Alt name
    SUMO2/3
  • gRNA/shRNA sequence
    SUMO2: GATCTGCCTCATTGACAAAC; SUMO3: AATCGAATCTGCCTCATTGAC
  • Species
    H. sapiens (human)
  • Entrez Gene
    SUMO2 (a.k.a. HSMT3, SMT3B, SMT3H2, SUMO3, Smt3A)
  • Entrez Gene
    SUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
  • Tag / Fusion Protein
    • EmGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site attB1 (unknown if destroyed)
  • 3′ cloning site attB2 (unknown if destroyed)
  • 5′ sequencing primer EGFP-C
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA6.2-GW/EmGFP-miR-SUMO23 was a gift from Wulf Paschen (Addgene plasmid # 31073)
  • For your References section:

    Gene expression and cell growth are modified by silencing SUMO2 and SUMO3 expression. Yang W, Paschen W. Biochem Biophys Res Commun. 2009 Apr 24. 382(1):215-8. 10.1016/j.bbrc.2009.03.013 PubMed 19275883