1
Plasmid 31117: pSR-puro-Sec5
  • Sec5 shRNA

  • SEC5

  • GGTCGGAAAGACAAGGCAGAT

  • H. sapiens (human)

  • EXOC2 (RP11-164H16.2, FLJ11026, SEC5, SEC5L1, Sec5p)

  • pSUPER.retro.puro
    (Search Vector Database)

  • Oligoengine

  • Mammalian Expression, Retroviral, RNAi

  • 6349

  • pLXSN 5' List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • View sequences (1)
  • Christopher Counter

  • MTA

Comments: 

shRNA Sec5 sequence:
5'-GGTCGGAAAGACAAGGCAGAT-3'

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Sec5 and Exo84 foster oncogenic ras-mediated tumorigenesis. Issaq et al (Mol Cancer Res. 2010 Feb . 8(2):223-31. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31117" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with