1
Plasmid 31221: pDEST-HemmarG
  • CD4-tdGFP

  • 2340

  • H. sapiens (human), D. melanogaster (fly)

  • Aequorea victoria

  • CD4 (CD4mut)

  • CD4

  • N terminal on insert

  • EGFP/GFP

  • C terminal on insert

  • Fusion of signal peptide of Drosophila Akh gene, human CD4 transmembrane domain, EGFP, GFP, and Kir2.1 ER exit signal.

  • pAPIC-HIH
    (Search Vector Database)

  • Insect Expression

  • 10193

  • XhoI

  • No

  • XbaI

  • No

  • ACTGCAACTACTGAAATCTGCC List of Sequencing Primers

  • GGCGCACAGAAATGATTACAAC

  • Ampicillin

  • ccdB Survival

  • 37

  • ccdB Survivalâ„¢ 2 T1R Cells @ 37C.

  • High Copy

  • View sequences (3)
  • View map

  • Yuh-Nung Jan

  • MTA

Comments: 

Gateway destination vector for cloning any enhancer to drive expression of membrane marker CD4-tdGFP

The depositing laboratory recommends growing bacteria either on LB plates with 80 ug/ml Carbenicillin or in LB liquid media with 60 ug/ml Carbenicillin (a semi-synthetic ampicillin analog)

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Enhancer-driven membrane markers for analysis of nonautonomous mechanisms reveal neuron-glia interactions in Drosophila. Han et al (Proc Natl Acad Sci U S A. 2011 May 23. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31221" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only