MSCV-Nkx2-1*/Neo
(Plasmid #31272)

• Depositing Labs: Tyler Jacks, Monte Winslow
• Publication: Winslow et al Nature. 2011 May 5. 473(7345):101-4.

Backbone

• Vector backbone: pMSCVNeo
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6500
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nkx2-1*
• Alt name: Nkx2-1 with silent mutations
• Species: M. musculus (mouse)
• Insert Size (bp): 1118
• Mutation: A shNkx2-1 insensitive Nkx2-1 cDNA was created by engineering four silent mutations using QuikChange® Lightning Site-Directed Mutagenesis (Stratagene) and the following primers: 5’ GGTCCGACCATAAAGCAAAGTGGAGCAGGACATGGCGCCATAGTCCGAG 3’ 5’ CTCGGACTATGGCGCCATGTCCTGCTCCACTTTGCTTTATGGTCGGACC 3’ followed by sequence verification and cloning into the MSCV-Puro retroviral expression vector.
• Entrez Gene: Nkx2-1 (a.k.a. Nkx2.1, T/EBP, Titf1, Ttf-1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: pLXSN 5'
• 3′ sequencing primer: MSCV rev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry