pQStrep2-UBL3
(Plasmid #31330)

• Depositing Lab: Konrad Buessow
• Publication: Bussow et al Microb Cell Fact. 2005 Jul 5. 4():21.

Backbone

• Vector backbone: pQStrep2
• Backbone size w/o insert (bp): 3460
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ubiquitin-like 3
• Alt name: PSFEp758A0510
• Species: H. sapiens (human)
• Insert Size (bp): 420
• GenBank ID: DQ000501
• Entrez Gene: UBL3 (a.k.a. HCG-1, PNSC1)
• Tags / Fusion Proteins:
  • His (N terminal on backbone)
  • TEV (N terminal on backbone)
  • StrepII-tag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TGAGCGGATAACAATTTCACACAG
• 3′ sequencing primer: GGCAACCGAGCGTTCTGAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct.