FuPick-shRNA
(Plasmid
#31614)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUGW+H
- Backbone size w/o insert (bp) 9000
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePICK1 shRNA
-
Alt namePick1
-
SpeciesR. norvegicus (rat)
-
Entrez GenePick1 (a.k.a. Prkcabp)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer H1 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PICK1 shRNA: CTATGAGTACCGCCTTATCCT
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FuPick-shRNA was a gift from Robert Malenka (Addgene plasmid # 31614 ; http://n2t.net/addgene:31614 ; RRID:Addgene_31614) -
For your References section:
Calcium binding to PICK1 is essential for the intracellular retention of AMPA receptors underlying long-term depression. Citri A, Bhattacharyya S, Ma C, Morishita W, Fang S, Rizo J, Malenka RC. J Neurosci. 2010 Dec 8. 30(49):16437-52. 10.1523/JNEUROSCI.4478-10.2010 PubMed 21147983
