Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTight-9-124
(Plasmid #31874)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31874 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTLemiR
  • Backbone manufacturer
    home made/Crabtree lab
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-9/9* and miR-124
  • Alt name
    miR-9/9* and miR-124 pri-transcripts
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    655
  • GenBank ID
    NR_029818 NR_029814
  • Entrez Gene
    Mir124a-2 (a.k.a. Mirn12, Mirn124a-2, mir-124, mir-124-2, mir-124a-2)
  • Entrez Gene
    Mir9-3 (a.k.a. Mirn9-3, mir-9-3, mmu-mir-9-3)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CACTTCGTGGACCACAGACTGG
  • 3′ sequencing primer GCACACCGGCCTTATTCCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's quality control sequence is missing the following sequence upstream of IRES - "CCGCAAATT". This deletion should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTight-9-124 was a gift from Jerry Crabtree (Addgene plasmid # 31874 ; http://n2t.net/addgene:31874 ; RRID:Addgene_31874)
  • For your References section:

    MicroRNA-mediated conversion of human fibroblasts to neurons. Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR. Nature. 2011 Jul 13. doi: 10.1038/nature10323. 10.1038/nature10323 PubMed 21753754