1
Plasmid 31874: pTight-9-124
  • miR-9/9* and miR-124

  • miR-9/9* and miR-124 pri-transcripts

  • 655

  • M. musculus (mouse)

  • NR_029818 NR_029814

  • pTLemiR
    (Search Vector Database)

  • home made/Crabtree lab

  • Lentiviral

  • Ligation Independent Cloning

  • CACTTCGTGGACCACAGACTGG List of Sequencing Primers

  • GCACACCGGCCTTATTCCAAG

  • Ampicillin

  • Stbl3

  • 30

  • High Copy

  • Puromycin

  • View sequences (2)
  • View map

  • Jerry Crabtree

  • MTA

Comments: 

Addgene's quality control sequence is missing the following sequence upstream of IRES - "CCGCAAATT". This deletion should not affect plasmid function.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: MicroRNA-mediated conversion of human fibroblasts to neurons. Yoo et al (Nature. 2011 Jul 13. doi: 10.1038/nature10323. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31874" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only