1
Plasmid 31875: pTight-hND2-N106
  • NeuroD2

  • ND2

  • 1184

  • H. sapiens (human)

  • NEUROD2 (NDRF, bHLHa1)

  • pTight-N106
    (Search Vector Database)

  • home made/Crabtree lab

  • Lentiviral

  • 7602

  • Ligation Independent Cloning

  • atgtcgaggtaggcgtgtac List of Sequencing Primers

  • gtggatgtggaatgtgtgcga

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • Blasticidin

  • View sequences (2)
  • View map

  • Jerry Crabtree

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: MicroRNA-mediated conversion of human fibroblasts to neurons. Yoo et al (Nature. 2011 Jul 13. doi: 10.1038/nature10323. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31875" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only