(Plasmid #31875)

Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
    home made/Crabtree lab
  • Backbone size w/o insert (bp) 7602
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    NEUROD2 (a.k.a. NDRF, bHLHa1)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer atgtcgaggtaggcgtgtac
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTight-hND2-N106 was a gift from Jerry Crabtree (Addgene plasmid # 31875)
  • For your References section:

    MicroRNA-mediated conversion of human fibroblasts to neurons. Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR. Nature. 2011 Jul 13. doi: 10.1038/nature10323. 10.1038/nature10323 PubMed 21753754