Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pPATagRFP-a-tubulin
(Plasmid #31934)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31934 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-a-Tubulin
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5334
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PATagRFP
  • Alt name
    photoactivatable dark-to-red TagRFP red fluorescent protein
  • Insert Size (bp)
    705
  • Mutation
    R69S/F84W/Q139K/A147P/N148S/M151K/Y153K/S165V/H203R/R207I/V218W/C229S compared to TagRFP (but numbering relative to EGFP).
  • Promoter CMV
  • Tag / Fusion Protein
    • a-tubulin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site BglII (unknown if destroyed)
  • 5′ sequencing primer cggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPATagRFP-a-tubulin was a gift from Vladislav Verkhusha (Addgene plasmid # 31934)
  • For your References section:

    Bright monomeric photoactivatable red fluorescent protein for two-color super-resolution sptPALM of live cells. Subach FV, Patterson GH, Renz M, Lippincott-Schwartz J, Verkhusha VV. J Am Chem Soc. 2010 May 12;132(18):6481-91. 10.1021/ja100906g PubMed 20394363