-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerAddgene Plasmid 8453
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAtg13
-
gRNA/shRNA sequenceGATTTGCACTCGTTCATCAT
-
SpeciesH. sapiens (human)
-
Entrez GeneATG13 (a.k.a. KIAA0652, PARATARG8)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sh-RNA hAtg13 was a gift from Do-Hyung Kim (Addgene plasmid # 31971 ; http://n2t.net/addgene:31971 ; RRID:Addgene_31971) -
For your References section:
ULK-Atg13-FIP200 complexes mediate mTOR signaling to the autophagy machinery. Jung CH, Jun CB, Ro SH, Kim YM, Otto NM, Cao J, Kundu M, Kim DH. Mol Biol Cell. 2009 Apr;20(7):1992-2003. Epub 2009 Feb 18. 10.1091/mbc.e08-12-1249 PubMed 19225151