Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

sh-RNA hAtg13
(Plasmid #31971)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31971 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    Addgene Plasmid 8453
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Atg13
  • gRNA/shRNA sequence
    GATTTGCACTCGTTCATCAT
  • Species
    H. sapiens (human)
  • Entrez Gene
    ATG13 (a.k.a. KIAA0652, PARATARG8)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sh-RNA hAtg13 was a gift from Do-Hyung Kim (Addgene plasmid # 31971 ; http://n2t.net/addgene:31971 ; RRID:Addgene_31971)
  • For your References section:

    ULK-Atg13-FIP200 complexes mediate mTOR signaling to the autophagy machinery. Jung CH, Jun CB, Ro SH, Kim YM, Otto NM, Cao J, Kundu M, Kim DH. Mol Biol Cell. 2009 Apr;20(7):1992-2003. Epub 2009 Feb 18. 10.1091/mbc.e08-12-1249 PubMed 19225151