pEGFP-STAG2-K225insNM
(Plasmid
#31974)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4727
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman STAG2 cDNA
-
Alt namestromal antigen 2
-
Alt nameSA-2
-
SpeciesH. sapiens (human)
-
Mutationinserted amino acids Asn-Met before Lys225
-
Entrez GeneSTAG2 (a.k.a. SA-2, SA2, SCC3B, bA517O1.1)
-
Tags
/ Fusion Proteins
- EGFP (N terminal on backbone)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tcaggctgtaaaggagttgtca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-STAG2-K225insNM was a gift from Todd Waldman (Addgene plasmid # 31974 ; http://n2t.net/addgene:31974 ; RRID:Addgene_31974) -
For your References section:
Mutational inactivation of STAG2 causes aneuploidy in human cancer. Solomon DA, Kim T, Diaz-Martinez LA, Fair J, Elkahloun AG, Harris BT, Toretsky JA, Rosenberg SA, Shukla N, Ladanyi M, Samuels Y, James CD, Yu H, Kim JS, Waldman T. Science. 2011 Aug 19;333(6045):1039-43. 10.1126/science.1203619 PubMed 21852505