1
Plasmid 31977: pEGFP-STAG2-Q735Stop
  • human STAG2 cDNA

  • stromal antigen 2

  • SA-2

  • H. sapiens (human)

  • STAG2 (RP11-517O1.1, SA-2, SA2, SCC3B, bA517O1.1)

  • EGFP

  • N terminal on backbone

  • changed Glutamine 735 to Stop codon

  • pEGFP-C3
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • 4727

  • Ligation Independent Cloning

  • gcatttggatgccttattgc List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (3)
  • Todd Waldman

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Mutational inactivation of STAG2 causes aneuploidy in human cancer. Solomon et al (Science. 2011 Aug 19;333(6045):1039-43. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31977" in your Materials and Methods section.